ROUGE

Gene/Protein Characteristic Table for mKIAA1216

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129312
Description :	Mediator subunit SUR2.
Clone Name :	mpm03053 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4789 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 630 bp

Genome contig ID gi65524842f_24746292
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
AAGTTAGAAATGAAATAAAGCCGTGCTCAGACGTC
Flanking genome sequence
(143406 - 143455)
----+----*----+----*----+----*----+----*----+----*
TGATTGCCTGACTGCTTTGTAACTGAATCATTCGCCTCTCTGGGGCCATG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1216 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1216	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..4159
Length: 1385 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q80YQ2	100.0	Mediator of RNA...	Mus musculus
AAH50916	99.9	Mediator comple...	Mus musculus
Q5EB59	99.0	Mediator of RNA...	Rattus norvegicus
XP_001057683	98.7	similar to cofa...	Rattus norvegicus
AAM28897	98.3	mediator subuni...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

None - - - - -

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 973 995 YFGNVCLRFLPVFDIVIHRFLEL

Method	From	To	amino acid sequence
SOSUI	973	995	YFGNVCLRFLPVFDIVIHRFLEL

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	630 bp
Genome contig ID	gi65524842f_24746292
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AAGTTAGAAATGAAATAAAGCCGTGCTCAGACGTC
Flanking genome sequence (143406 - 143455)	----+--------+--------+--------+--------+----* TGATTGCCTGACTGCTTTGTAACTGAATCATTCGCCTCTCTGGGGCCATG

Gene/Protein Characteristic Table for mKIAA1216

Features of the cloned DNA sequence

Features of the protein sequence