ROUGE

Gene/Protein Characteristic Table for mKIAA1197

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122463
Description :
Clone Name :	mbg08216 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5653 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 4574 bp

Genome contig ID gi65546577f_18812722
PolyA signal sequence
(AATAAA,-11)
+----*----+----*----+----*----+----
CAATGTACTTACATATAATAAATAAATAAATCTTT
Flanking genome sequence
(150052 - 150101)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAGTAATTCTTAACCTCTTCAAATAGAGAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1197 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1197	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1073, 4267..4986
Length: 597 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDK97560	1.1e-182	98.7	mCG128458 [Mus ...	Mus musculus
Q3TUF7	1.4e-181	99.3	YEATS domain-co...	Mus musculus
EDL77987	1.3e-172	93.8	similar to YEAT...	Rattus norvegicus
AAH57045	3.8e-169	99.2	Yeats2 protein ...	Mus musculus
AAI50945	4.4e-165	99.8	Yeats2 protein ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005033 279 363 PF03366 YEATS

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005033	279	363	PF03366	YEATS

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	4574 bp
Genome contig ID	gi65546577f_18812722
PolyA signal sequence (AATAAA,-11)	+--------+--------+----*----+---- CAATGTACTTACATATAATAAATAAATAAATCTTT
Flanking genome sequence (150052 - 150101)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAGTAATTCTTAACCTCTTCAAATAGAGAG

Gene/Protein Characteristic Table for mKIAA1197

Features of the cloned DNA sequence

Features of the protein sequence