ROUGE

Gene/Protein Characteristic Table for mKIAA1189

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220372
Description :
Clone Name :	mbp03221 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 1016 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 12 bp

Genome contig ID gi66880554r_57873283
PolyA signal sequence
(TATAAA,-17)
+----*----+----*----+----*----+----
TTGAGTCAATGATGCACTTATAAACTAACGGGGAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CCGAGGAATGTAGGGAGTGTTAAAGGAAAGCTAACTTCTAACTTCCTTCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1189 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1189	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 15..1004
Length: 329 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL26933	1e-101	100.0	RIKEN cDNA A330...	Mus musculus
Q5EBJ4	1.1e-100	99.6	Ermin; Juxtanod...	Mus musculus
BAE23136	3.7e-100	99.3	unnamed protein...	Mus musculus
BAC37121	2.9e-71	87.9	unnamed protein...	Mus musculus
XP_849476	1.7e-61	63.3	hypothetical pr...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 217 269 PS50313 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	217	269	PS50313	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	12 bp
Genome contig ID	gi66880554r_57873283
PolyA signal sequence (TATAAA,-17)	+--------+--------+----*----+---- TTGAGTCAATGATGCACTTATAAACTAACGGGGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CCGAGGAATGTAGGGAGTGTTAAAGGAAAGCTAACTTCTAACTTCCTTCC

Gene/Protein Characteristic Table for mKIAA1189

Features of the cloned DNA sequence

Features of the protein sequence