ROUGE

Gene/Protein Characteristic Table for mKIAA1181

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173123
Description :
Clone Name :	mph04621 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2720 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1757 bp

Genome contig ID gi65550231f_24256358
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
TGGGTTCAATTAGATATTAAAAGGCTGCTTTTCAG
Flanking genome sequence
(195410 - 195459)
----+----*----+----*----+----*----+----*----+----*
AAATATTGCTGTGACTCTGCCTTGATGGTGGCTGGGTAGCCCAGAGTCTA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1181 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1181	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..963
Length: 320 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001063333	8.5e-142	99.4	similar to Endo...	Rattus norvegicus
XP_001066818	1.1e-140	98.8	similar to Endo...	Rattus norvegicus
XP_001099287	5.3e-128	99.3	endoplasmic ret...	Macaca mulatta
Q9DC16	3.4e-127	100.0	Endoplasmic ret...	Mus musculus
Q969X5	1.4e-126	99.0	Endoplasmic ret...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR012936 115 317 PF07970 Protein of unknown function DUF1692

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012936	115	317	PF07970	Protein of unknown function DUF1692

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 56 78 AIISICCCLFILFLFLSELTGFI

Method	From	To	amino acid sequence
SOSUI	56	78	AIISICCCLFILFLFLSELTGFI

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1757 bp
Genome contig ID	gi65550231f_24256358
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TGGGTTCAATTAGATATTAAAAGGCTGCTTTTCAG
Flanking genome sequence (195410 - 195459)	----+--------+--------+--------+--------+----* AAATATTGCTGTGACTCTGCCTTGATGGTGGCTGGGTAGCCCAGAGTCTA

Gene/Protein Characteristic Table for mKIAA1181

Features of the cloned DNA sequence

Features of the protein sequence