ROUGE |
Gene/Protein Characteristic Table for mKIAA1167 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173119 |
---|---|
GRIP-associated protein 1. | |
mfj45274 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3371 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2059 bp Genome contig ID gi66880665f_5943315 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TGTGAGTATGTGTGTAAAGACTATGTGGCCAAAATFlanking genome sequence
(116164 - 116213) ----+----*----+----*----+----*----+----*----+----*
ACCATCTGGCCAGACGGGCCCACCCACTGACTGTCTGGTCTCATTCTTTT
KIAA Alignment based on: KIAA1167 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..1222, 2001..2156
Length: 459 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |