ROUGE

Gene/Protein Characteristic Table for mKIAA1135

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129296
Description :	Spir-1 protein isoform 1. Spir-1 protein.
Clone Name :	mpk02409 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 1190 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 0 bp

Genome contig ID gi65551972r_67650129
PolyA signal sequence
(ATTAAA,-10)
+----*----+----*----+----*----+----
CCTCCATGAAAGAATATTAGAAGAAATTAAAGCAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGAAAGCTTCGACCTGTGTCACCAGAAGAAATTAGACGGAGCAGACTA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1135 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1135	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1189
Length: 396 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_064533	2.1e-122	87.3	spire homolog 1...	Homo sapiens
BAG09977	2.1e-122	87.3	spire homolog 1...	synthetic construct
Q08AE8	2.1e-122	87.3	Protein spire h...	Homo sapiens
EDL09641	1.2e-93	100.0	spire homolog 1...	Mus musculus
EDL09640	1.3e-93	100.0	spire homolog 1...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	0 bp
Genome contig ID	gi65551972r_67650129
PolyA signal sequence (ATTAAA,-10)	+--------+--------+----*----+---- CCTCCATGAAAGAATATTAGAAGAAATTAAAGCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGAAAGCTTCGACCTGTGTCACCAGAAGAAATTAGACGGAGCAGACTA

Gene/Protein Characteristic Table for mKIAA1135

Features of the cloned DNA sequence

Features of the protein sequence