ROUGE

Gene/Protein Characteristic Table for mKIAA1104

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129292
Description :	pitrilysin metalloprotease 1. nuclear transplantation upregulated protein 1.
Clone Name :	mph01427 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3401 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 299 bp

Genome contig ID gi65535943f_6345120
PolyA signal sequence
(TATAAA,-22)
+----*----+----*----+----*----+----
TATGTATTTTAAATATAAAAGCCAACTCCAACCTG
Flanking genome sequence
(132021 - 132070)
----+----*----+----*----+----*----+----*----+----*
TCTGAGTTTTACTCATTATTTTCAAACAATAATTTACGACAATAATGTTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1104 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1104	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..3102
Length: 1033 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8K411	99.9	Presequence pro...	Mus musculus
BAE24630	99.8	unnamed protein...	Mus musculus
BAE39514	99.7	unnamed protein...	Mus musculus
AAX11356	99.5	pitrilysin meta...	Mus musculus
AAX11355	99.3	pitrilysin meta...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007863 241 429 PF05193 Peptidase M16

IPR007863 757 955 PF05193 Peptidase M16

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007863	241	429	PF05193	Peptidase M16
IPR007863	757	955	PF05193	Peptidase M16

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	299 bp
Genome contig ID	gi65535943f_6345120
PolyA signal sequence (TATAAA,-22)	+--------+--------+----*----+---- TATGTATTTTAAATATAAAAGCCAACTCCAACCTG
Flanking genome sequence (132021 - 132070)	----+--------+--------+--------+--------+----* TCTGAGTTTTACTCATTATTTTCAAACAATAATTTACGACAATAATGTTT

Gene/Protein Characteristic Table for mKIAA1104

Features of the cloned DNA sequence

Features of the protein sequence