ROUGE

Gene/Protein Characteristic Table for mKIAA1049

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122430
Description :	FKSG26 protein.
Clone Name :	mbg07836 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5002 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3104 bp

Genome contig ID gi65515060f_122648754
PolyA signal sequence
(AAGAAA,-22)
+----*----+----*----+----*----+----
AGAGAAAGTTCACAAGAAATGAAAGACTTTGAAAC
Flanking genome sequence
(129956 - 130005)
----+----*----+----*----+----*----+----*----+----*
AAAAACATGGTGATATGGCCTTTTTAACTTTGTTTTTTTTTTGTGTGTGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1049 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1049	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 396..1898
Length: 500 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL11735	100.0	transcription f...	Mus musculus
AAH46768	99.8	Transcription f...	Mus musculus
BAC41018	100.0	unnamed protein...	Mus musculus
EDL11736	100.0	transcription f...	Mus musculus
Q8R3L2	100.0	Transcription f...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006994 113 499 PF04910 Protein of unknown function DUF654

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006994	113	499	PF04910	Protein of unknown function DUF654

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3104 bp
Genome contig ID	gi65515060f_122648754
PolyA signal sequence (AAGAAA,-22)	+--------+--------+----*----+---- AGAGAAAGTTCACAAGAAATGAAAGACTTTGAAAC
Flanking genome sequence (129956 - 130005)	----+--------+--------+--------+--------+----* AAAAACATGGTGATATGGCCTTTTTAACTTTGTTTTTTTTTTGTGTGTGT

Gene/Protein Characteristic Table for mKIAA1049

Features of the cloned DNA sequence

Features of the protein sequence