ROUGE

Gene/Protein Characteristic Table for mKIAA1047

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AB093281
Description :	Nuclear receptor corepressor 1.
Clone Name :	mbg00559 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6328 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1153 bp

Genome contig ID gi65527427r_61942333
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CCTTTATTCATTAAGAATTGCTTGCTGTGATTCAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTGTTCTCCTATGGCTTCCTTCCACTGCATAAAGATGCTTAGTAGTGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1047 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1047	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..5175
Length: 1724 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI35317	100.0	nuclear recepto...	Mus musculus
AAL40135	99.9	RIP-13 [Mus mus...	Mus musculus
EDM04704	91.1	nuclear recepto...	Rattus norvegicus
NP_035438	97.8	nuclear recepto...	Mus musculus
AAH86657	94.6	Ncor1 protein [...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 991 1015 PS50323 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	991	1015	PS50323	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1153 bp
Genome contig ID	gi65527427r_61942333
PolyA signal sequence (None)	+--------+--------+----*----+---- CCTTTATTCATTAAGAATTGCTTGCTGTGATTCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTGTTCTCCTATGGCTTCCTTCCACTGCATAAAGATGCTTAGTAGTGT

Gene/Protein Characteristic Table for mKIAA1047

Features of the cloned DNA sequence

Features of the protein sequence