ROUGE

Gene/Protein Characteristic Table for mKIAA1038

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173091
Description :	Hbs1-like. eukaryotic release factor 3.
Clone Name :	mia33062 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 2733 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 583 bp

Genome contig ID gi65524842f_21137768
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AGTTGAGAAGCCAGCTAATAAAATGCCTTAGTTTG
Flanking genome sequence
(173453 - 173502)
----+----*----+----*----+----*----+----*----+----*
AATGTATTGCAAAAATGTGTTTTATTTCTTAGACATCTCTGAGGGAGTCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1038 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1038	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..2150
Length: 715 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q69ZS7	100.0	HBS1-like protein.	Mus musculus
AAH10251	99.9	Hbs1-like (S. c...	Mus musculus
BAE38593	99.6	unnamed protein...	Mus musculus
BAE27353	99.3	unnamed protein...	Mus musculus
EDL93813	96.8	rCG57303, isofo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000795 293 306 PR00315 Protein synthesis factor

IPR000795 352 360 PR00315 Protein synthesis factor

IPR000795 372 382 PR00315 Protein synthesis factor

IPR000795 388 399 PR00315 Protein synthesis factor

IPR000795 432 441 PR00315 Protein synthesis factor

HMMPfam IPR000795 289 512 PF00009 Protein synthesis factor

IPR004161 533 600 PF03144 Elongation factor Tu

IPR004160 606 714 PF03143 Elongation factor Tu

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000795	293	306	PR00315	Protein synthesis factor
IPR000795	352	360	PR00315	Protein synthesis factor
IPR000795	372	382	PR00315	Protein synthesis factor
IPR000795	388	399	PR00315	Protein synthesis factor
IPR000795	432	441	PR00315	Protein synthesis factor
HMMPfam	IPR000795	289	512	PF00009	Protein synthesis factor
IPR004161	533	600	PF03144	Elongation factor Tu
IPR004160	606	714	PF03143	Elongation factor Tu

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	583 bp
Genome contig ID	gi65524842f_21137768
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AGTTGAGAAGCCAGCTAATAAAATGCCTTAGTTTG
Flanking genome sequence (173453 - 173502)	----+--------+--------+--------+--------+----* AATGTATTGCAAAAATGTGTTTTATTTCTTAGACATCTCTGAGGGAGTCT

Gene/Protein Characteristic Table for mKIAA1038

Features of the cloned DNA sequence

Features of the protein sequence