ROUGE

Gene/Protein Characteristic Table for mKIAA1035

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122423
Description :	ATP/GTP binding protein 1. nuclear ATP/GTP-binding protein. Purkinje cell degeneration.
Clone Name :	mbh02325 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 3804 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 243 bp

Genome contig ID gi65535943r_58009493
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TATAGCATTGAATTATCAAATGATAGATTTACTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAGAACCCAAGAATCATTGCATGAATTTTTATCTCCTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1035 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1035	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2998..3561
Length: 187 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL41277	3.1e-71	99.4	ATP/GTP binding...	Mus musculus
Q641K1	3.7e-71	99.4	Cytosolic carbo...	Mus musculus
AAG37102	6.8e-71	98.8	nuclear ATP/GTP...	Mus musculus
EDL93892	2.3e-69	97.1	ATP/GTP binding...	Rattus norvegicus
BAB14505	3.3e-68	94.2	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	243 bp
Genome contig ID	gi65535943r_58009493
PolyA signal sequence (None)	+--------+--------+----*----+---- TATAGCATTGAATTATCAAATGATAGATTTACTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGAACCCAAGAATCATTGCATGAATTTTTATCTCCTG

Gene/Protein Characteristic Table for mKIAA1035

Features of the cloned DNA sequence

Features of the protein sequence