ROUGE |
Gene/Protein Characteristic Table for mKIAA0996 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129256 |
---|---|
Weakly similar to zinc-finger protein DZIP1 (Fragment). | |
mpm12090 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4580 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 2076 bp Genome contig ID gi65540054r_113332282 PolyA signal sequence
(AGTAAA,-18) +----*----+----*----+----*----+----
CATTCACCTACTGTACCAGTAAAGTCCTCCATCACFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACACTGCGACTGTGGCTGCTTATTAAGAAAACCGCTTGGCTAGCTTTATA
KIAA Alignment based on: KIAA0996 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 90..2504
Length: 804 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007087 | 190 | 213 | PF00096 | Zinc finger |
HMMSmart | IPR007087 | 190 | 213 | SM00355 | Zinc finger |
ProfileScan | IPR007087 | 190 | 218 | PS50157 | Zinc finger |
ScanRegExp | IPR007087 | 192 | 213 | PS00028 | Zinc finger |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |