ROUGE

Gene/Protein Characteristic Table for mKIAA0983

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173078
Description :	Fms interacting protein. serum/glucocorticoid regulated kinase 2.
Clone Name :	msj09357 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 2074 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 128 bp

Genome contig ID gi65527427f_4695950
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
GATACCAGCTAATTAAAATGTCATCTGACAAATGG
Flanking genome sequence
(127706 - 127755)
----+----*----+----*----+----*----+----*----+----*
ACTCTGTTTGTAGCTCCTTGGGCAGTCTGGAAGAGCAGGTGGGACCATGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0983 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0983	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1946
Length: 647 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8BKT7	100.0	THO complex sub...	Mus musculus
BAC34398	99.8	unnamed protein...	Mus musculus
AAH39758	99.8	THO complex 5 [...	Mus musculus
EDM00256	97.8	rCG36131, isofo...	Rattus norvegicus
Q68FX7	97.7	THO complex sub...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	128 bp
Genome contig ID	gi65527427f_4695950
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- GATACCAGCTAATTAAAATGTCATCTGACAAATGG
Flanking genome sequence (127706 - 127755)	----+--------+--------+--------+--------+----* ACTCTGTTTGTAGCTCCTTGGGCAGTCTGGAAGAGCAGGTGGGACCATGG

Gene/Protein Characteristic Table for mKIAA0983

Features of the cloned DNA sequence

Features of the protein sequence