ROUGE

Gene/Protein Characteristic Table for mKIAA0971

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129251
Description :
Clone Name :	mpm12282 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3470 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2358 bp

Genome contig ID gi65488608f_63924417
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
GATTTTAATAAAGGCTGTGATTCAGTTATTCGTGG
Flanking genome sequence
(121077 - 121126)
----+----*----+----*----+----*----+----*----+----*
ATCAGCTGGCTGATCACTGCAACAATGGTATTTTCAGGTTGGGTTAAAGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0971 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0971	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1043, 2394..3182
Length: 610 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL00192	4e-152	93.7	FAST kinase dom...	Mus musculus
BAE28423	7.3e-138	93.2	unnamed protein...	Mus musculus
Q922E6	7.3e-138	93.4	FAST kinase dom...	Mus musculus
BAE38740	1.6e-137	92.7	unnamed protein...	Mus musculus
BAE32254	4.9e-137	93.0	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010622 435 594 PF06743 FAST kinase leucine-rich

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010622	435	594	PF06743	FAST kinase leucine-rich

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2358 bp
Genome contig ID	gi65488608f_63924417
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- GATTTTAATAAAGGCTGTGATTCAGTTATTCGTGG
Flanking genome sequence (121077 - 121126)	----+--------+--------+--------+--------+----* ATCAGCTGGCTGATCACTGCAACAATGGTATTTTCAGGTTGGGTTAAAGA

Gene/Protein Characteristic Table for mKIAA0971

Features of the cloned DNA sequence

Features of the protein sequence