ROUGE

Gene/Protein Characteristic Table for mKIAA0945

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129243
Description :
Clone Name :	mpm04066 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4577 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1943 bp

Genome contig ID gi66880554f_118315478
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TTCTTTAAGAAAAATAAATAAATTTGAGAAATTGT
Flanking genome sequence
(122888 - 122937)
----+----*----+----*----+----*----+----*----+----*
ATTGATTTAGAAAAGAGTTATTTTCTGTGTGTTTTGTTTTGAGTTTGGCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0945 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0945	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 214..2634
Length: 806 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_347036	97.8	similar to brom...	Rattus norvegicus
Q497V6	100.0	Bromo adjacent ...	Mus musculus
CAM19753	99.7	bromo adjacent ...	Mus musculus
AAI45234	99.6	Bahd1 protein [...	Mus musculus
XP_001080776	98.1	similar to brom...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001025 650 805 PF01426 Bromo adjacent region

HMMSmart IPR001025 650 805 SM00439 Bromo adjacent region

ProfileScan IPR000694 301 568 PS50099 Proline-rich region

NULL 582 613 PS50323 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001025	650	805	PF01426	Bromo adjacent region
HMMSmart	IPR001025	650	805	SM00439	Bromo adjacent region
ProfileScan	IPR000694	301	568	PS50099	Proline-rich region
NULL	582	613	PS50323	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1943 bp
Genome contig ID	gi66880554f_118315478
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTCTTTAAGAAAAATAAATAAATTTGAGAAATTGT
Flanking genome sequence (122888 - 122937)	----+--------+--------+--------+--------+----* ATTGATTTAGAAAAGAGTTATTTTCTGTGTGTTTTGTTTTGAGTTTGGCT

Gene/Protein Characteristic Table for mKIAA0945

Features of the cloned DNA sequence

Features of the protein sequence