ROUGE |
Gene/Protein Characteristic Table for mKIAA0920 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173063 |
---|---|
A-kinase anchor protein 2. | |
meg02347 [Vector Info] | |
Source : | Mouse embryonic intestinal tract |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7625 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 4621 bp Genome contig ID gi65493515f_57697956 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TGCTGATGGTAATGATGGTGGTGGTGCTGATGTAGFlanking genome sequence None
KIAA Alignment based on: KIAA0920 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 521..3004
Length: 827 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |