ROUGE

Gene/Protein Characteristic Table for mKIAA0920

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173063
Description :	A-kinase anchor protein 2.
Clone Name :	meg02347 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 7625 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4621 bp

Genome contig ID gi65493515f_57697956
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGCTGATGGTAATGATGGTGGTGGTGCTGATGTAG
Flanking genome sequence None

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0920 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0920	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 521..3004
Length: 827 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAM21286	99.9	A kinase (PRKA)...	Mus musculus
CAM21293	99.9	Palm2-Akap2 fus...	Mus musculus
CAM21288	99.9	Palm2-Akap2 fus...	Mus musculus
EDL02242	100.0	mCG2708, isofor...	Mus musculus
BAC36571	99.9	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 311 353 PS50322 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	311	353	PS50322	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4621 bp
Genome contig ID	gi65493515f_57697956
PolyA signal sequence (None)	+--------+--------+----*----+---- TGCTGATGGTAATGATGGTGGTGGTGCTGATGTAG
Flanking genome sequence	None

Gene/Protein Characteristic Table for mKIAA0920

Features of the cloned DNA sequence

Features of the protein sequence