ROUGE

Gene/Protein Characteristic Table for mKIAA0841

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129228
Description :
Clone Name :	mph02136 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3457 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 263 bp

Genome contig ID gi65511124r_25966404
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
CCAAACTTCATCTCCCTCAATAAAGCATTTCAAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGCACTGCCCAGTTTTATCAACTTTGTCTTGACACAGACCTGCAGTTC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0841 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0841	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1383..1994, 2157..3194
Length: 549 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAI18935	3.6e-201	99.6	RIKEN cDNA 2310...	Mus musculus
AAH89002	3.6e-201	99.6	2310022K01Rik p...	Mus musculus
XP_001001304	3.7e-201	99.6	similar to 2310...	Mus musculus
XP_355883	3.7e-201	99.6	hypothetical pr...	Mus musculus
EDM07727	1.2e-175	88.2	rCG53815 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 241 461 PS50319 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	241	461	PS50319	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	263 bp
Genome contig ID	gi65511124r_25966404
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- CCAAACTTCATCTCCCTCAATAAAGCATTTCAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGCACTGCCCAGTTTTATCAACTTTGTCTTGACACAGACCTGCAGTTC

Gene/Protein Characteristic Table for mKIAA0841

Features of the cloned DNA sequence

Features of the protein sequence