ROUGE

Gene/Protein Characteristic Table for mKIAA0828

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122382
Description :	RIKEN cDNA 4631427C17. clone MNCb-5555. EST AI227036.
Clone Name :	mbg03869 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4903 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3263 bp

Genome contig ID gi65504368f_29817387
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ATGTAATCTCAAAAAATAAAGTATTCTTAAAACTG
Flanking genome sequence
(142022 - 142071)
----+----*----+----*----+----*----+----*----+----*
ATCTGTGTCCTGAGAATACCACTTAATTCTGTGAACTATGAATTCAGAGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0828 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0828	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 204..1640
Length: 478 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_532429	6.7e-204	100.0	similar to Puta...	Canis lupus fam...
NP_001124195	6.7e-204	100.0	S-adenosylhomoc...	Homo sapiens
BAG58657	6.7e-204	100.0	unnamed protein...	Homo sapiens
NP_001124194	6.7e-204	100.0	S-adenosylhomoc...	Homo sapiens
XP_849026	6.7e-204	100.0	similar to Puta...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000043 51 477 PF05221 S-adenosyl-L-homocysteine hydrolase

IPR000043 237 398 PF00670 S-adenosyl-L-homocysteine hydrolase

HMMTigr IPR000043 53 470 TIGR00936 S-adenosyl-L-homocysteine hydrolase

ScanRegExp IPR000043 124 138 PS00738 S-adenosyl-L-homocysteine hydrolase

IPR000043 259 276 PS00739 S-adenosyl-L-homocysteine hydrolase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 7 28 FSIVEEASLFLIDFFICVPAAS

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000043	51	477	PF05221	S-adenosyl-L-homocysteine hydrolase
IPR000043	237	398	PF00670	S-adenosyl-L-homocysteine hydrolase
HMMTigr	IPR000043	53	470	TIGR00936	S-adenosyl-L-homocysteine hydrolase
ScanRegExp	IPR000043	124	138	PS00738	S-adenosyl-L-homocysteine hydrolase
IPR000043	259	276	PS00739	S-adenosyl-L-homocysteine hydrolase

Method	From	To	amino acid sequence
SOSUI	7	28	FSIVEEASLFLIDFFICVPAAS

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3263 bp
Genome contig ID	gi65504368f_29817387
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATGTAATCTCAAAAAATAAAGTATTCTTAAAACTG
Flanking genome sequence (142022 - 142071)	----+--------+--------+--------+--------+----* ATCTGTGTCCTGAGAATACCACTTAATTCTGTGAACTATGAATTCAGAGA

Gene/Protein Characteristic Table for mKIAA0828

Features of the cloned DNA sequence

Features of the protein sequence