ROUGE

Gene/Protein Characteristic Table for mKIAA0766

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122366
Description :	EPM2A (laforin) interacting protein 1.
Clone Name :	mbg07350 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6343 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5313 bp

Genome contig ID gi65519420f_111214050
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
ATGATCATTATGAATAAAATTGCTGTTAAAAGCCT
Flanking genome sequence
(106347 - 106396)
----+----*----+----*----+----*----+----*----+----*
TGTGTTTGTCTTTCAGTGACCATGTGTTACCCTTCCTTCTGGTGTATTCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0766 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0766	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1030
Length: 342 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8VEH5	5.6e-143	100.0	EPM2A-interacti...	Mus musculus
EDL08973	5.7e-143	100.0	EPM2A (laforin)...	Mus musculus
EDL08974	5.9e-143	100.0	EPM2A (laforin)...	Mus musculus
XP_001076356	2.6e-141	99.1	similar to EPM2...	Rattus norvegicus
EDL77035	2.7e-141	99.1	rCG25289 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5313 bp
Genome contig ID	gi65519420f_111214050
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ATGATCATTATGAATAAAATTGCTGTTAAAAGCCT
Flanking genome sequence (106347 - 106396)	----+--------+--------+--------+--------+----* TGTGTTTGTCTTTCAGTGACCATGTGTTACCCTTCCTTCTGGTGTATTCC

Gene/Protein Characteristic Table for mKIAA0766

Features of the cloned DNA sequence

Features of the protein sequence