ROUGE

Gene/Protein Characteristic Table for mKIAA0720

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129198
Description :
Clone Name :	mbf02832 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 2050 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 551 bp

Genome contig ID gi65493515f_150500765
PolyA signal sequence
(TATAAA,-22)
+----*----+----*----+----*----+----
AGTTTGGCTATTCTATAAAGACTTGTATATACTTC
Flanking genome sequence
(106990 - 107039)
----+----*----+----*----+----*----+----*----+----*
CGTGGAAAGAGTCATGCGCTTCTGGAACGCCCTCTCTTCCCTGTTCCTCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0720 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA0720	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 3..1499
Length: 498 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAM24581	2e-159	100.0	pleckstrin homo...	Mus musculus
CAP19199	2e-159	100.0	pleckstrin homo...	Mus musculus
Q66T02	2e-159	100.0	Pleckstrin homo...	Mus musculus
AAU04954	7.3e-159	100.0	RhoA-specific g...	Mus musculus
AAH23181	2e-153	100.0	Plekhg5 protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 80 179 PF00169 Pleckstrin-like

HMMSmart IPR001849 80 181 SM00233 Pleckstrin-like

ProfileScan IPR001849 79 179 PS50003 Pleckstrin-like

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	80	179	PF00169	Pleckstrin-like
HMMSmart	IPR001849	80	181	SM00233	Pleckstrin-like
ProfileScan	IPR001849	79	179	PS50003	Pleckstrin-like

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	551 bp
Genome contig ID	gi65493515f_150500765
PolyA signal sequence (TATAAA,-22)	+--------+--------+----*----+---- AGTTTGGCTATTCTATAAAGACTTGTATATACTTC
Flanking genome sequence (106990 - 107039)	----+--------+--------+--------+--------+----* CGTGGAAAGAGTCATGCGCTTCTGGAACGCCCTCTCTTCCCTGTTCCTCT

Gene/Protein Characteristic Table for mKIAA0720

Features of the cloned DNA sequence

Features of the protein sequence