ROUGE

Gene/Protein Characteristic Table for mKIAA0719

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122356
Description :	Mitochondrial precursor proteins import receptor.
Clone Name :	mbg09205 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5881 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3964 bp

Genome contig ID gi65546577f_55926458
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ATGAAAACAATTTTTAATAAAAAGTTTTAAAAGTG
Flanking genome sequence
(135115 - 135164)
----+----*----+----*----+----*----+----*----+----*
TCATGTTGATGGGATATTAGCACCATGAAAATTAGTGTTCTGGTAAATGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0719 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0719	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 37..1917
Length: 626 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC38960	9.6e-212	100.0	unnamed protein...	Mus musculus
BAE36547	1.8e-211	99.8	unnamed protein...	Mus musculus
Q9CZW5	2.6e-211	99.8	Mitochondrial i...	Mus musculus
Q75Q39	9.5e-208	98.5	Mitochondrial i...	Rattus norvegicus
XP_535719	2.8e-199	92.0	similar to Mito...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001440 132 165 PF00515 TPR repeat

NULL 132 165 PF07719 NULL

IPR001440 171 204 PF00515 TPR repeat

NULL 171 204 PF07719 NULL

IPR001440 205 238 PF00515 TPR repeat

IPR001440 347 380 PF00515 TPR repeat

IPR001440 385 418 PF00515 TPR repeat

IPR001440 419 452 PF00515 TPR repeat

IPR001440 460 493 PF00515 TPR repeat

IPR001440 494 527 PF00515 TPR repeat

NULL 494 527 PF07719 NULL

IPR001440 528 562 PF00515 TPR repeat

IPR001440 563 596 PF00515 TPR repeat

HMMSmart IPR001440 132 165 SM00028 TPR repeat

IPR001440 171 204 SM00028 TPR repeat

IPR001440 205 238 SM00028 TPR repeat

IPR001440 347 380 SM00028 TPR repeat

IPR001440 385 418 SM00028 TPR repeat

IPR001440 419 452 SM00028 TPR repeat

IPR001440 460 493 SM00028 TPR repeat

IPR001440 494 527 SM00028 TPR repeat

IPR001440 528 562 SM00028 TPR repeat

IPR001440 563 596 SM00028 TPR repeat

ProfileScan IPR001440 132 596 PS50293 TPR repeat

IPR001440 132 165 PS50005 TPR repeat

IPR001440 171 204 PS50005 TPR repeat

IPR001440 419 452 PS50005 TPR repeat

IPR001440 494 527 PS50005 TPR repeat

IPR001440 563 596 PS50005 TPR repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001440	132	165	PF00515	TPR repeat
NULL	132	165	PF07719	NULL
IPR001440	171	204	PF00515	TPR repeat
NULL	171	204	PF07719	NULL
IPR001440	205	238	PF00515	TPR repeat
IPR001440	347	380	PF00515	TPR repeat
IPR001440	385	418	PF00515	TPR repeat
IPR001440	419	452	PF00515	TPR repeat
IPR001440	460	493	PF00515	TPR repeat
IPR001440	494	527	PF00515	TPR repeat
NULL	494	527	PF07719	NULL
IPR001440	528	562	PF00515	TPR repeat
IPR001440	563	596	PF00515	TPR repeat
HMMSmart	IPR001440	132	165	SM00028	TPR repeat
IPR001440	171	204	SM00028	TPR repeat
IPR001440	205	238	SM00028	TPR repeat
IPR001440	347	380	SM00028	TPR repeat
IPR001440	385	418	SM00028	TPR repeat
IPR001440	419	452	SM00028	TPR repeat
IPR001440	460	493	SM00028	TPR repeat
IPR001440	494	527	SM00028	TPR repeat
IPR001440	528	562	SM00028	TPR repeat
IPR001440	563	596	SM00028	TPR repeat
ProfileScan	IPR001440	132	596	PS50293	TPR repeat
IPR001440	132	165	PS50005	TPR repeat
IPR001440	171	204	PS50005	TPR repeat
IPR001440	419	452	PS50005	TPR repeat
IPR001440	494	527	PS50005	TPR repeat
IPR001440	563	596	PS50005	TPR repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3964 bp
Genome contig ID	gi65546577f_55926458
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ATGAAAACAATTTTTAATAAAAAGTTTTAAAAGTG
Flanking genome sequence (135115 - 135164)	----+--------+--------+--------+--------+----* TCATGTTGATGGGATATTAGCACCATGAAAATTAGTGTTCTGGTAAATGT

Gene/Protein Characteristic Table for mKIAA0719

Features of the cloned DNA sequence

Features of the protein sequence