ROUGE |
Gene/Protein Characteristic Table for mKIAA0709 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129195 |
---|---|
mannose receptor, C type 2. novel lectin. |
|
mpg01116 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4227 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1220 bp Genome contig ID gi65527427f_105054713 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
ATAGCAAACAAATAAAAACCTTCCAGAGGCTTGAGFlanking genome sequence
(117519 - 117568) ----+----*----+----*----+----*----+----*----+----*
AAGTCAGCGTTTGTGCCTCCTTCTCTGCAGAGTCTGACCCCCGCAGCCCT
KIAA Alignment based on: KIAA0709 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 2..3007
Length: 1001 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |