ROUGE

Gene/Protein Characteristic Table for mKIAA0692

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129192
Description :
Clone Name :	mpm04187 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4369 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2794 bp

Genome contig ID gi65498774f_109185386
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
GAAATATTTTCATTAAAAAGGACATTGAGTAGCAC
Flanking genome sequence
(122050 - 122099)
----+----*----+----*----+----*----+----*----+----*
ATTGATGTCTGGGAGATGTCTTACTATGTTACCCCAATGGCCTGGAACTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0692 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0692	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1557, 1575..2237
Length: 739 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q6P1H6	4.2e-209	90.5	Ankyrin repeat ...	Mus musculus
BAE21022	4.2e-209	90.5	unnamed protein...	Mus musculus
AAH65071	4.7e-208	90.3	Ankyrin repeat ...	Mus musculus
EDM14061	8.3e-193	81.3	similar to Ab2-...	Rattus norvegicus
Q7TP65	8.6e-193	80.2	Ankyrin repeat ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2794 bp
Genome contig ID	gi65498774f_109185386
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- GAAATATTTTCATTAAAAAGGACATTGAGTAGCAC
Flanking genome sequence (122050 - 122099)	----+--------+--------+--------+--------+----* ATTGATGTCTGGGAGATGTCTTACTATGTTACCCCAATGGCCTGGAACTG

Gene/Protein Characteristic Table for mKIAA0692

Features of the cloned DNA sequence

Features of the protein sequence