ROUGE

Gene/Protein Characteristic Table for mKIAA0673

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172998
Description :	Nephrocystin 4.
Clone Name :	mfj10186 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4341 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 406 bp

Genome contig ID gi65493515f_150889067
PolyA signal sequence
(AATGAA,-24)
+----*----+----*----+----*----+----
TTAAGTTATTGAATGAAGCACCACATTTCTGCCGT
Flanking genome sequence
(166481 - 166530)
----+----*----+----*----+----*----+----*----+----*
AGTGTCTCTTCTGATGTTTTTCTGGGGCTTCCTCCTGCTGGAGTGATGGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0673 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0673	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..3935
Length: 1310 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAM23668	99.8	nephronophthisi...	Mus musculus
P59240	99.7	Nephrocystin-4;...	Mus musculus
EDL81239	92.9	rCG31055, isofo...	Rattus norvegicus
O75161	78.0	Nephrocystin-4;...	Homo sapiens
CAH72673	78.0	nephronophthisi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	406 bp
Genome contig ID	gi65493515f_150889067
PolyA signal sequence (AATGAA,-24)	+--------+--------+----*----+---- TTAAGTTATTGAATGAAGCACCACATTTCTGCCGT
Flanking genome sequence (166481 - 166530)	----+--------+--------+--------+--------+----* AGTGTCTCTTCTGATGTTTTTCTGGGGCTTCCTCCTGCTGGAGTGATGGG

Gene/Protein Characteristic Table for mKIAA0673

Features of the cloned DNA sequence

Features of the protein sequence