ROUGE

Gene/Protein Characteristic Table for mKIAA0663

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122341
Description :
Clone Name :	mbg20856 [Vector Info]
Source :	Mouse brain
Note :	We replaced mbh04695, former representative clones for mKIAA0663 with mbg20856. (2004/6/22)

Features of the cloned DNA sequence	Description

Length: 5376 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 0 bp

Genome contig ID gi65488608r_133388109
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AAGAGGCTGCTCCGCATCACCAAGAGAGCAGGTGT
Flanking genome sequence
(99999 - 99950)
----+----*----+----*----+----*----+----*----+----*
TGTATAGCCCCTCCAAACTGTGTCACTGTTCCAGCACAGGGCAGCACCTA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0663 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0663	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3791..5374
Length: 528 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL39641	3.2e-190	100.0	mCG131554, isof...	Mus musculus
AAH05786	9e-176	100.0	Zinc finger CCC...	Mus musculus
Q6NZF1	9e-176	100.0	Zinc finger CCC...	Mus musculus
BAE39744	2.9e-175	99.8	unnamed protein...	Mus musculus
AAH66848	1.8e-174	99.4	Zc3h11a protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	0 bp
Genome contig ID	gi65488608r_133388109
PolyA signal sequence (None)	+--------+--------+----*----+---- AAGAGGCTGCTCCGCATCACCAAGAGAGCAGGTGT
Flanking genome sequence (99999 - 99950)	----+--------+--------+--------+--------+----* TGTATAGCCCCTCCAAACTGTGTCACTGTTCCAGCACAGGGCAGCACCTA

Gene/Protein Characteristic Table for mKIAA0663

Features of the cloned DNA sequence

Features of the protein sequence