ROUGE |
Gene/Protein Characteristic Table for mKIAA0645 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129180 |
---|---|
DEP domain containing protein 5. | |
mbg01435 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5211 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 441 bp Genome contig ID gi65498774f_31252212 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TACATAGCAGAATCTAATAAAGCCCTCCCTCCCTCFlanking genome sequence
(227913 - 227962) ----+----*----+----*----+----*----+----*----+----*
CCTCCCTCCCTCCCTCTCTCCCTCCCCCGGTGTCTGTTCCCAGCCTTGTT
KIAA Alignment based on: KIAA0645 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..445, 502..4770
Length: 1570 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000591 | 1154 | 1227 | PF00610 | Pleckstrin/ G-protein |
HMMSmart | IPR000591 | 1154 | 1229 | SM00049 | Pleckstrin/ G-protein |
ProfileScan | IPR000591 | 1154 | 1229 | PS50186 | Pleckstrin/ G-protein |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |