ROUGE |
Gene/Protein Characteristic Table for mKIAA0640 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK172990 |
---|---|
SWAP complex protein. SWAP complex protein, 70 kDa. |
|
mpj04359 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2963 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1160 bp Genome contig ID gi65511124f_103974638 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
AGATTTTGGGCTGCTTAATAAAAGTAATTTTATTTFlanking genome sequence
(160733 - 160782) ----+----*----+----*----+----*----+----*----+----*
AATGTTTATAGTTGCCTTCATACAGTTTAGATTTGTGTGCAAAGTATCAC
KIAA Alignment based on: KIAA0640 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 28..1803
Length: 591 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |