ROUGE

Gene/Protein Characteristic Table for mKIAA0640

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172990
Description :	SWAP complex protein. SWAP complex protein, 70 kDa.
Clone Name :	mpj04359 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2963 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1160 bp

Genome contig ID gi65511124f_103974638
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AGATTTTGGGCTGCTTAATAAAAGTAATTTTATTT
Flanking genome sequence
(160733 - 160782)
----+----*----+----*----+----*----+----*----+----*
AATGTTTATAGTTGCCTTCATACAGTTTAGATTTGTGTGCAAAGTATCAC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0640 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0640	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 28..1803
Length: 591 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q6A028	6.4e-174	99.7	Switch-associat...	Mus musculus
AAH65136	2.1e-173	99.5	SWA-70 protein ...	Mus musculus
EDM17868	2.1e-172	98.5	SWAP complex pr...	Rattus norvegicus
XP_542503	1.1e-170	96.8	similar to SWA-...	Canis lupus fam...
Q9UH65	9.5e-167	95.0	Switch-associat...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 217 312 PF00169 Pleckstrin-like

HMMSmart IPR001849 217 314 SM00233 Pleckstrin-like

ProfileScan IPR002048 9 79 PS50222 Calcium-binding EF-hand

IPR001849 216 312 PS50003 Pleckstrin-like

NULL 339 524 PS50313 NULL

IPR002017 423 515 PS50083 Spectrin repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	217	312	PF00169	Pleckstrin-like
HMMSmart	IPR001849	217	314	SM00233	Pleckstrin-like
ProfileScan	IPR002048	9	79	PS50222	Calcium-binding EF-hand
IPR001849	216	312	PS50003	Pleckstrin-like
NULL	339	524	PS50313	NULL
IPR002017	423	515	PS50083	Spectrin repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1160 bp
Genome contig ID	gi65511124f_103974638
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AGATTTTGGGCTGCTTAATAAAAGTAATTTTATTT
Flanking genome sequence (160733 - 160782)	----+--------+--------+--------+--------+----* AATGTTTATAGTTGCCTTCATACAGTTTAGATTTGTGTGCAAAGTATCAC

Gene/Protein Characteristic Table for mKIAA0640

Features of the cloned DNA sequence

Features of the protein sequence