ROUGE

Gene/Protein Characteristic Table for mKIAA0626

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122332
Description :
Clone Name :	mbg10563 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5210 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4157 bp

Genome contig ID gi65515060f_59593750
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ATTTTACATTTCACCAATAAAGCCTTCAAACCAAT
Flanking genome sequence
(119344 - 119393)
----+----*----+----*----+----*----+----*----+----*
AACGAAGTTCATTTTATTAATAGCCTTTTATGATTTCTTCAGAGATTAAC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0626 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0626	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1053
Length: 350 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9D3X9	7.2e-131	100.0	Microfibrillar-...	Mus musculus
EDL28636	7.9e-131	100.0	microfibrillar-...	Mus musculus
EDL28635	8.5e-131	100.0	microfibrillar-...	Mus musculus
Q6AYP2	1.3e-126	96.9	Microfibrillar-...	Rattus norvegicus
XP_001084068	7.7e-119	90.3	microfibrillar-...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam NULL 1 84 PF07679 NULL

IPR007110 2 68 PF00047 Immunoglobulin-like

HMMSmart IPR003599 1 84 SM00409 Immunoglobulin subtype

IPR003598 1 73 SM00408 Immunoglobulin C2 type

ProfileScan IPR007110 1 82 PS50835 Immunoglobulin-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	NULL	1	84	PF07679	NULL
IPR007110	2	68	PF00047	Immunoglobulin-like
HMMSmart	IPR003599	1	84	SM00409	Immunoglobulin subtype
IPR003598	1	73	SM00408	Immunoglobulin C2 type
ProfileScan	IPR007110	1	82	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 94 116 YMVVCLVAFTIVMILNITRLCMM

Method	From	To	amino acid sequence
SOSUI	94	116	YMVVCLVAFTIVMILNITRLCMM

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4157 bp
Genome contig ID	gi65515060f_59593750
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ATTTTACATTTCACCAATAAAGCCTTCAAACCAAT
Flanking genome sequence (119344 - 119393)	----+--------+--------+--------+--------+----* AACGAAGTTCATTTTATTAATAGCCTTTTATGATTTCTTCAGAGATTAAC

Gene/Protein Characteristic Table for mKIAA0626

Features of the cloned DNA sequence

Features of the protein sequence