ROUGE

Gene/Protein Characteristic Table for mKIAA0589

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122319
Description :	phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma.
Clone Name :	mfj20194 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4324 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2206 bp

Genome contig ID gi65524842f_81329179
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TTTTTGAGATCTGTAATAAATCTCTAATAAGAAAC
Flanking genome sequence
(126255 - 126304)
----+----*----+----*----+----*----+----*----+----*
AGCTCCTCTCCGGTGACTTATGCGTGCGTGCGATGGGAGAGCAGGCGAAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0589 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0589	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..2118
Length: 705 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001009967	98.5	phosphatidylino...	Rattus norvegicus
Q5I6B8	98.3	Phosphatidylino...	Rattus norvegicus
O70161	96.2	Phosphatidylino...	Mus musculus
BAA25664	95.9	phosphatidylino...	Mus musculus
AAH19138	100.0	Pip5k1c protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002498 175 461 PF01504 Phosphatidylinositol-4-phosphate 5-kinase

HMMSmart IPR002498 121 462 SM00330 Phosphatidylinositol-4-phosphate 5-kinase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002498	175	461	PF01504	Phosphatidylinositol-4-phosphate 5-kinase
HMMSmart	IPR002498	121	462	SM00330	Phosphatidylinositol-4-phosphate 5-kinase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2206 bp
Genome contig ID	gi65524842f_81329179
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTTTTGAGATCTGTAATAAATCTCTAATAAGAAAC
Flanking genome sequence (126255 - 126304)	----+--------+--------+--------+--------+----* AGCTCCTCTCCGGTGACTTATGCGTGCGTGCGATGGGAGAGCAGGCGAAG

Gene/Protein Characteristic Table for mKIAA0589

Features of the cloned DNA sequence

Features of the protein sequence