ROUGE

Gene/Protein Characteristic Table for mKIAA0582

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172975
Description :	RIKEN clone 6030463E10. RIKEN cDNA 6030463E10.
Clone Name :	mpj02907 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2714 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 722 bp

Genome contig ID gi65527427r_20033181
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
AGTCACTTTTACAAAATAAAATCTCAAGTAACTGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTCTTGTAGCTCAGTTGACTATTTTATCTGATAAATCGAATTAAGATGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0582 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0582	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 58..1992
Length: 644 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE27346	100.0	unnamed protein...	Mus musculus
EDL07833	100.0	centrosomal pro...	Mus musculus
AAH27174	100.0	Cep68 protein [...	Mus musculus
Q8C0D9	100.0	Centrosomal pro...	Mus musculus
BAC27484	99.8	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	722 bp
Genome contig ID	gi65527427r_20033181
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AGTCACTTTTACAAAATAAAATCTCAAGTAACTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTCTTGTAGCTCAGTTGACTATTTTATCTGATAAATCGAATTAAGATGT

Gene/Protein Characteristic Table for mKIAA0582

Features of the cloned DNA sequence

Features of the protein sequence