ROUGE

Gene/Protein Characteristic Table for mKIAA0542

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129159
Description :
Clone Name :	mph01978 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3271 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1977 bp

Genome contig ID gi65527427r_2926674
PolyA signal sequence
(AATGAA,-17)
+----*----+----*----+----*----+----
CAAAATGTCTTGCAATGAAATGAATTACTGTTCAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGTCTCCTACTTTTCATACAAAATACGGTACTACTGATAGGGTTGAAAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0542 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0542	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 530..1231, 2768..3130
Length: 354 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAX15524	6.3e-98	84.0	Sfi1 homolog, s...	Mus musculus
CAI26156	6.5e-98	84.0	Sfi1 homolog, s...	Mus musculus
Q3UZY0	6.6e-98	84.0	Protein SFI1 ho...	Mus musculus
CAI35197	1.6e-97	92.9	Sfi1 homolog, s...	Mus musculus
XP_223587	3.5e-82	84.8	similar to spin...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1977 bp
Genome contig ID	gi65527427r_2926674
PolyA signal sequence (AATGAA,-17)	+--------+--------+----*----+---- CAAAATGTCTTGCAATGAAATGAATTACTGTTCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTCTCCTACTTTTCATACAAAATACGGTACTACTGATAGGGTTGAAAA

Gene/Protein Characteristic Table for mKIAA0542

Features of the cloned DNA sequence

Features of the protein sequence