ROUGE

Gene/Protein Characteristic Table for mKIAA0534

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172967
Description :	Weakly similar to DJ741H3.1.2 (Fragment).
Clone Name :	mpf00179 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 6567 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2124 bp

Genome contig ID gi65553144f_57096774
PolyA signal sequence
(AATAAA,-33)
+----*----+----*----+----*----+----
GAAATAAAATTCTTCACCCCCGGGTGAAGTGAACC
Flanking genome sequence
(622298 - 622347)
----+----*----+----*----+----*----+----*----+----*
AAAAACCACCTCGTTCTCTGTGTCTTCCTCCTCCCACTGCACATCCTAAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0534 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0534	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 109..4443
Length: 1444 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6A051	99.9	Attractin-like ...	Mus musculus
AAT99560	99.9	attractin-like ...	Mus musculus
XP_217657	93.9	similar to attr...	Rattus norvegicus
Q5VV63	95.9	Attractin-like ...	Homo sapiens
EAW49461	95.9	attractin-like ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AB093245	4.8e-119	59.9	mKIAA0548
AK122377	7.1e-23	23.0	mKIAA0817
AK129157	7.9e-08	29.1	mKIAA0533
AK122567	1.1e-05	26.5	mKIAA1894
AK220215	9.3e-05	25.7	mKIAA0149

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000859 158 271 PF00431 CUB

NULL 314 345 PF07974 NULL

IPR006652 369 415 PF01344 Kelch repeat

IPR011498 419 467 PF07646 Kelch

IPR006652 419 467 PF01344 Kelch repeat

IPR006652 531 583 PF01344 Kelch repeat

IPR011498 585 639 PF07646 Kelch

IPR006652 585 639 PF01344 Kelch repeat

IPR011498 645 689 PF07646 Kelch

IPR006652 645 689 PF01344 Kelch repeat

IPR002165 731 774 PF01437 Plexin

IPR002165 780 825 PF01437 Plexin

IPR001304 830 939 PF00059 C-type lectin

IPR002165 954 1004 PF01437 Plexin

IPR002165 1007 1077 PF01437 Plexin

IPR002049 1079 1122 PF00053 Laminin-type EGF-like

HMMSmart IPR000859 158 274 SM00042 CUB

IPR003659 679 722 SM00423 Plexin/semaphorin/integrin

IPR003659 731 774 SM00423 Plexin/semaphorin/integrin

IPR003659 780 825 SM00423 Plexin/semaphorin/integrin

IPR001304 813 938 SM00034 C-type lectin

IPR003659 954 1004 SM00423 Plexin/semaphorin/integrin

IPR003659 1007 1077 SM00423 Plexin/semaphorin/integrin

ProfileScan IPR000859 158 274 PS01180 CUB

IPR001304 820 938 PS50041 C-type lectin

NULL 951 1156 PS50311 NULL

IPR002049 1076 1120 PS50027 Laminin-type EGF-like

ScanRegExp IPR006209 144 155 PS00022 EGF-like

IPR006209 144 158 PS01186 EGF-like

IPR006209 298 309 PS00022 EGF-like

IPR006209 334 345 PS00022 EGF-like

IPR002049 1093 1127 PS01248 Laminin-type EGF-like

IPR006034 1227 1235 PS00144 Asparaginase/glutaminase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000859	158	271	PF00431	CUB
NULL	314	345	PF07974	NULL
IPR006652	369	415	PF01344	Kelch repeat
IPR011498	419	467	PF07646	Kelch
IPR006652	419	467	PF01344	Kelch repeat
IPR006652	531	583	PF01344	Kelch repeat
IPR011498	585	639	PF07646	Kelch
IPR006652	585	639	PF01344	Kelch repeat
IPR011498	645	689	PF07646	Kelch
IPR006652	645	689	PF01344	Kelch repeat
IPR002165	731	774	PF01437	Plexin
IPR002165	780	825	PF01437	Plexin
IPR001304	830	939	PF00059	C-type lectin
IPR002165	954	1004	PF01437	Plexin
IPR002165	1007	1077	PF01437	Plexin
IPR002049	1079	1122	PF00053	Laminin-type EGF-like
HMMSmart	IPR000859	158	274	SM00042	CUB
IPR003659	679	722	SM00423	Plexin/semaphorin/integrin
IPR003659	731	774	SM00423	Plexin/semaphorin/integrin
IPR003659	780	825	SM00423	Plexin/semaphorin/integrin
IPR001304	813	938	SM00034	C-type lectin
IPR003659	954	1004	SM00423	Plexin/semaphorin/integrin
IPR003659	1007	1077	SM00423	Plexin/semaphorin/integrin
ProfileScan	IPR000859	158	274	PS01180	CUB
IPR001304	820	938	PS50041	C-type lectin
NULL	951	1156	PS50311	NULL
IPR002049	1076	1120	PS50027	Laminin-type EGF-like
ScanRegExp	IPR006209	144	155	PS00022	EGF-like
IPR006209	144	158	PS01186	EGF-like
IPR006209	298	309	PS00022	EGF-like
IPR006209	334	345	PS00022	EGF-like
IPR002049	1093	1127	PS01248	Laminin-type EGF-like
IPR006034	1227	1235	PS00144	Asparaginase/glutaminase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 1294 1316 DLVQFFVTFFSCFLSLLLVAAVV

Method	From	To	amino acid sequence
SOSUI	1294	1316	DLVQFFVTFFSCFLSLLLVAAVV

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2124 bp
Genome contig ID	gi65553144f_57096774
PolyA signal sequence (AATAAA,-33)	+--------+--------+----*----+---- GAAATAAAATTCTTCACCCCCGGGTGAAGTGAACC
Flanking genome sequence (622298 - 622347)	----+--------+--------+--------+--------+----* AAAAACCACCTCGTTCTCTGTGTCTTCCTCCTCCCACTGCACATCCTAAA

Gene/Protein Characteristic Table for mKIAA0534

Features of the cloned DNA sequence

Features of the protein sequence