ROUGE |
Gene/Protein Characteristic Table for mKIAA0534 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK172967 |
---|---|
Weakly similar to DJ741H3.1.2 (Fragment). | |
mpf00179 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6567 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2124 bp Genome contig ID gi65553144f_57096774 PolyA signal sequence
(AATAAA,-33) +----*----+----*----+----*----+----
GAAATAAAATTCTTCACCCCCGGGTGAAGTGAACCFlanking genome sequence
(622298 - 622347) ----+----*----+----*----+----*----+----*----+----*
AAAAACCACCTCGTTCTCTGTGTCTTCCTCCTCCCACTGCACATCCTAAA
KIAA Alignment based on: KIAA0534 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 109..4443
Length: 1444 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000859 | 158 | 271 | PF00431 | CUB |
NULL | 314 | 345 | PF07974 | NULL | |
IPR006652 | 369 | 415 | PF01344 | Kelch repeat | |
IPR011498 | 419 | 467 | PF07646 | Kelch | |
IPR006652 | 419 | 467 | PF01344 | Kelch repeat | |
IPR006652 | 531 | 583 | PF01344 | Kelch repeat | |
IPR011498 | 585 | 639 | PF07646 | Kelch | |
IPR006652 | 585 | 639 | PF01344 | Kelch repeat | |
IPR011498 | 645 | 689 | PF07646 | Kelch | |
IPR006652 | 645 | 689 | PF01344 | Kelch repeat | |
IPR002165 | 731 | 774 | PF01437 | Plexin | |
IPR002165 | 780 | 825 | PF01437 | Plexin | |
IPR001304 | 830 | 939 | PF00059 | C-type lectin | |
IPR002165 | 954 | 1004 | PF01437 | Plexin | |
IPR002165 | 1007 | 1077 | PF01437 | Plexin | |
IPR002049 | 1079 | 1122 | PF00053 | Laminin-type EGF-like | |
HMMSmart | IPR000859 | 158 | 274 | SM00042 | CUB |
IPR003659 | 679 | 722 | SM00423 | Plexin/semaphorin/integrin | |
IPR003659 | 731 | 774 | SM00423 | Plexin/semaphorin/integrin | |
IPR003659 | 780 | 825 | SM00423 | Plexin/semaphorin/integrin | |
IPR001304 | 813 | 938 | SM00034 | C-type lectin | |
IPR003659 | 954 | 1004 | SM00423 | Plexin/semaphorin/integrin | |
IPR003659 | 1007 | 1077 | SM00423 | Plexin/semaphorin/integrin | |
ProfileScan | IPR000859 | 158 | 274 | PS01180 | CUB |
IPR001304 | 820 | 938 | PS50041 | C-type lectin | |
NULL | 951 | 1156 | PS50311 | NULL | |
IPR002049 | 1076 | 1120 | PS50027 | Laminin-type EGF-like | |
ScanRegExp | IPR006209 | 144 | 155 | PS00022 | EGF-like |
IPR006209 | 144 | 158 | PS01186 | EGF-like | |
IPR006209 | 298 | 309 | PS00022 | EGF-like | |
IPR006209 | 334 | 345 | PS00022 | EGF-like | |
IPR002049 | 1093 | 1127 | PS01248 | Laminin-type EGF-like | |
IPR006034 | 1227 | 1235 | PS00144 | Asparaginase/glutaminase |
Method | From | To | amino acid sequence |
---|---|---|---|
SOSUI | 1294 | 1316 | DLVQFFVTFFSCFLSLLLVAAVV |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |