ROUGE |
Gene/Protein Characteristic Table for mKIAA0522 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220345 |
---|---|
mbp09103 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2909 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 966 bp Genome contig ID gi66880665f_145646488 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GAGGACCACCCTGAGCCCAAGATGTCGTTCTGCCAFlanking genome sequence
(112762 - 112811) ----+----*----+----*----+----*----+----*----+----*
GGCAGAGATTGAAGCCATCAGAGCAGGGGCTGTGAGCCAGAATGCCCAAG
KIAA Alignment based on: KIAA0522 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..1943
Length: 646 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000904 | 2 | 99 | PF01369 | SEC7-like |
HMMSmart | IPR000904 | 1 | 99 | SM00222 | SEC7-like |
IPR001849 | 130 | 241 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR000904 | 2 | 97 | PS50190 | SEC7-like |
IPR000694 | 332 | 639 | PS50099 | Proline-rich region | |
NULL | 397 | 409 | PS50316 | NULL |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |