ROUGE

Gene/Protein Characteristic Table for mKIAA0467

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129152
Description :
Clone Name :	mbg08277 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6387 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 585 bp

Genome contig ID gi65493515r_117221651
PolyA signal sequence
(AATATA,-16)
+----*----+----*----+----*----+----
ATGTGTCCCCCACCCCTGTAATATACACATATGAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACGCTCAGTGTGATTTTAATTCAGAGGAGGGGACTCCGGACACTAACAC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0467 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA0467	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 2..2008, 3247..5802
Length: 1520 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001477707	91.6	hypothetical pr...	Mus musculus
CAM15198	91.6	novel protein [...	Mus musculus
EAX07098	84.7	hCG2036582, iso...	Homo sapiens
EAX07096	84.7	hCG2036582, iso...	Homo sapiens
XP_613325	83.0	similar to hCG2...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 1129 1180 PS50316 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	1129	1180	PS50316	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	585 bp
Genome contig ID	gi65493515r_117221651
PolyA signal sequence (AATATA,-16)	+--------+--------+----*----+---- ATGTGTCCCCCACCCCTGTAATATACACATATGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACGCTCAGTGTGATTTTAATTCAGAGGAGGGGACTCCGGACACTAACAC

Gene/Protein Characteristic Table for mKIAA0467

Features of the cloned DNA sequence

Features of the protein sequence