ROUGE

Gene/Protein Characteristic Table for mKIAA0436

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129142
Description :	solute carrier family 3, member 1.
Clone Name :	mpj02793 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2196 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 115 bp

Genome contig ID gi65550231r_82794378
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTTTTTTTAAGTTATTATATAATTTTTTAAAAGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GTCTCTTTGTGTAATTTTGCTTAATACTTGCTCATACTGTTCCCACCAGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0436 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0436	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 627..2081
Length: 484 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH04612	1.6e-211	100.0	Prepl protein [...	Mus musculus
BAC38751	1.6e-211	100.0	unnamed protein...	Mus musculus
BAC34440	1.7e-211	100.0	unnamed protein...	Mus musculus
Q8C167	1.8e-211	100.0	Prolyl endopept...	Mus musculus
AAH89111	4.7e-209	98.3	Prolyl endopept...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001375 245 470 PF00326 Peptidase S9

ProfileScan IPR000379 230 331 PS50187 Esterase/lipase/thioesterase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001375	245	470	PF00326	Peptidase S9
ProfileScan	IPR000379	230	331	PS50187	Esterase/lipase/thioesterase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	115 bp
Genome contig ID	gi65550231r_82794378
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTTTTTTAAGTTATTATATAATTTTTTAAAAGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GTCTCTTTGTGTAATTTTGCTTAATACTTGCTCATACTGTTCCCACCAGC

Gene/Protein Characteristic Table for mKIAA0436

Features of the cloned DNA sequence

Features of the protein sequence