ROUGE

Gene/Protein Characteristic Table for mKIAA0415

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129135
Description :
Clone Name :	mpm04351 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4174 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 841 bp

Genome contig ID gi65498774f_141371365
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
TGCAGGAAAAATAAACTAAAGAATTATTTATGCTG
Flanking genome sequence
(113746 - 113795)
----+----*----+----*----+----*----+----*----+----*
AGCAGTGGTGGCACATGCCTTTCATCTCAGCACTCAGGAGGTAGAGGCAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0415 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0415	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..722, 2467..3165, 3371..3856
Length: 634 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC38605	2.9e-90	85.2	unnamed protein...	Mus musculus
BAC30747	3.2e-90	82.4	unnamed protein...	Mus musculus
XP_001480758	3.8e-90	73.3	hypothetical pr...	Mus musculus
XP_001480761	3.8e-90	72.2	hypothetical pr...	Mus musculus
XP_001480764	3.8e-90	72.3	hypothetical pr...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	841 bp
Genome contig ID	gi65498774f_141371365
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- TGCAGGAAAAATAAACTAAAGAATTATTTATGCTG
Flanking genome sequence (113746 - 113795)	----+--------+--------+--------+--------+----* AGCAGTGGTGGCACATGCCTTTCATCTCAGCACTCAGGAGGTAGAGGCAG

Gene/Protein Characteristic Table for mKIAA0415

Features of the cloned DNA sequence

Features of the protein sequence