ROUGE

Gene/Protein Characteristic Table for mKIAA0355

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129125
Description :
Clone Name :	mpm10241 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4788 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2217 bp

Genome contig ID gi65511124r_29290503
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
AAAATAACTTGGCTTTATTAAAATATACATTTAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATACTCTGTATCTTTTTTAAATTAATTGCAGCAGATATGTGGCTCTCAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0355 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0355	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..2571
Length: 856 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL03038	99.7	RIKEN cDNA 4931...	Mus musculus
BAC36555	99.5	unnamed protein...	Mus musculus
AAH60233	99.4	RIKEN cDNA 4931...	Mus musculus
BAE41629	99.6	unnamed protein...	Mus musculus
EDM07644	98.2	rCG53802, isofo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 468 535 PS50322 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	468	535	PS50322	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2217 bp
Genome contig ID	gi65511124r_29290503
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- AAAATAACTTGGCTTTATTAAAATATACATTTAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATACTCTGTATCTTTTTTAAATTAATTGCAGCAGATATGTGGCTCTCAG

Gene/Protein Characteristic Table for mKIAA0355

Features of the cloned DNA sequence

Features of the protein sequence