ROUGE |
Gene/Protein Characteristic Table for mKIAA0262 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129106 |
---|---|
ring finger protein 10. RIE2 protein. |
|
mph02016 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3099 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 214 bp Genome contig ID gi65498774r_114251398 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
CTTTACACCAGAATAAAGTATTGACACTCAACTTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGCCGCCTTCCCGACAAGCATATTCATTTGTAGCCCTTAAGTTCCTTCAT
KIAA Alignment based on: KIAA0262 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 411..2885
Length: 824 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |