ROUGE

Gene/Protein Characteristic Table for mKIAA0251

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK004611
Description :
Clone Name :	mid06092 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 2829 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 663 bp

Genome contig ID gi65546577r_12470149
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TGTCTCACAAAAGGAATAAAAGAAAGGTCTGGGTC
Flanking genome sequence
(99873 - 99824)
----+----*----+----*----+----*----+----*----+----*
TTTTGCTTTTGTTGCTGTTTGTCTGTCTTGTTTTTGAGACAGGGACTGAC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0251 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0251	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..2166
Length: 721 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDK97379	100.0	mCG129810, isof...	Mus musculus
EDK97380	100.0	mCG129810, isof...	Mus musculus
BAB23408	100.0	unnamed protein...	Mus musculus
Q99K01	100.0	Pyridoxal-depen...	Mus musculus
BAC35732	100.0	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002129 112 406 PF00282 Pyridoxal-dependent decarboxylase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002129	112	406	PF00282	Pyridoxal-dependent decarboxylase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	663 bp
Genome contig ID	gi65546577r_12470149
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGTCTCACAAAAGGAATAAAAGAAAGGTCTGGGTC
Flanking genome sequence (99873 - 99824)	----+--------+--------+--------+--------+----* TTTTGCTTTTGTTGCTGTTTGTCTGTCTTGTTTTTGAGACAGGGACTGAC

Gene/Protein Characteristic Table for mKIAA0251

Features of the cloned DNA sequence

Features of the protein sequence