ROUGE |
Gene/Protein Characteristic Table for mKIAA0242 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129098 |
---|---|
UBX domain-containing protein 2. | |
mpj02648 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2411 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1826 bp Genome contig ID gi65488608f_128012859 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
CTTTATTTTTAAATAAATGGGATCATATTGTATGTFlanking genome sequence
(109509 - 109558) ----+----*----+----*----+----*----+----*----+----*
ACTACCCTGCATTTTGCTCTTTCCTTACAGTCTCAAAGACCTCGACCTGC
KIAA Alignment based on: KIAA0242 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..585
Length: 194 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |