ROUGE

Gene/Protein Characteristic Table for mKIAA0232

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122224
Description :
Clone Name :	mbg08537 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6267 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2134 bp

Genome contig ID gi65498774r_34988962
PolyA signal sequence
(AATAAA,-11)
+----*----+----*----+----*----+----
TGTTTTTTTGTGGAGTTAAAACCAAATAAAAATTT
Flanking genome sequence
(99946 - 99897)
----+----*----+----*----+----*----+----*----+----*
CAAAAAATGTTTGTTGTTTTTATTTATCATAGCAATCTTTTAAAGTGAAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0232 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0232	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..4133
Length: 1376 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDM00043	95.9	rCG35767 [Rattu...	Rattus norvegicus
BAE23979	99.8	unnamed protein...	Mus musculus
XP_001057070	96.0	hypothetical pr...	Rattus norvegicus
XP_001057015	95.7	hypothetical pr...	Rattus norvegicus
XP_001091530	88.3	hypothetical pr...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 177 279 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	177	279	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2134 bp
Genome contig ID	gi65498774r_34988962
PolyA signal sequence (AATAAA,-11)	+--------+--------+----*----+---- TGTTTTTTTGTGGAGTTAAAACCAAATAAAAATTT
Flanking genome sequence (99946 - 99897)	----+--------+--------+--------+--------+----* CAAAAAATGTTTGTTGTTTTTATTTATCATAGCAATCTTTTAAAGTGAAT

Gene/Protein Characteristic Table for mKIAA0232

Features of the cloned DNA sequence

Features of the protein sequence