ROUGE

Gene/Protein Characteristic Table for mKIAA0162

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129069
Description :	suppressor of Ty 6 homolog.
Clone Name :	mbh03558 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4249 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 559 bp

Genome contig ID gi65527427r_77832684
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CGCCTGTCATTTGAATAAACAGTGTTTGTACAGAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CGCTTGCCGAGGCCTCCAGCTCCCTCGCTCTGTAGGGCTGCTTCAGCAGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0162 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0162	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..3690
Length: 1229 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q62383	100.0	Transcription e...	Mus musculus
AAB18950	99.9	Supt6h.	Mus musculus
XP_239258	99.7	similar to Tran...	Rattus norvegicus
XP_868225	99.1	similar to supp...	Canis lupus fam...
XP_537747	99.1	similar to supp...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000980 838 918 PF00017 SH2 motif

HMMSmart IPR003029 724 785 SM00316 RNA binding S1

IPR000980 835 924 SM00252 SH2 motif

ProfileScan IPR003029 730 785 PS50126 RNA binding S1

IPR000980 828 934 PS50001 SH2 motif

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000980	838	918	PF00017	SH2 motif
HMMSmart	IPR003029	724	785	SM00316	RNA binding S1
IPR000980	835	924	SM00252	SH2 motif
ProfileScan	IPR003029	730	785	PS50126	RNA binding S1
IPR000980	828	934	PS50001	SH2 motif

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	559 bp
Genome contig ID	gi65527427r_77832684
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CGCCTGTCATTTGAATAAACAGTGTTTGTACAGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CGCTTGCCGAGGCCTCCAGCTCCCTCGCTCTGTAGGGCTGCTTCAGCAGT

Gene/Protein Characteristic Table for mKIAA0162

Features of the cloned DNA sequence

Features of the protein sequence