ROUGE

Gene/Protein Characteristic Table for mKIAA0160

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122213
Description :	Polycomb protein Suz12.
Clone Name :	mbh04611 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4304 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2296 bp

Genome contig ID gi65527427f_79618877
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
ACGTTTGTTTTTACATTAAATGTTTATTTGAAATC
Flanking genome sequence
(140853 - 140902)
----+----*----+----*----+----*----+----*----+----*
AAATGATTTTGTACATAAAGTTCAATAATATAAAGCTGTCTTCTGCTTTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0160 DNA sequence

KIAA	Alignment based on:
KIAA0160	DNA sequence

Features of the protein sequence	Description

Coding region: 2..1990, 2007..2426
Length: 802 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL15617	99.4	suppressor of z...	Mus musculus
Q80U70	99.3	Polycomb protei...	Mus musculus
XP_582605	96.5	similar to Poly...	Bos taurus
XP_548278	96.4	similar to join...	Canis lupus fam...
XP_001174690	96.4	joined to JAZF1...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000104 92 106 PR00308 Antifreeze protein

IPR000104 123 132 PR00308 Antifreeze protein

ProfileScan NULL 39 116 PS50315 NULL

NULL 95 135 PS50310 NULL

ScanRegExp IPR007087 518 539 PS00028 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000104	92	106	PR00308	Antifreeze protein
IPR000104	123	132	PR00308	Antifreeze protein
ProfileScan	NULL	39	116	PS50315	NULL
NULL	95	135	PS50310	NULL
ScanRegExp	IPR007087	518	539	PS00028	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2296 bp
Genome contig ID	gi65527427f_79618877
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- ACGTTTGTTTTTACATTAAATGTTTATTTGAAATC
Flanking genome sequence (140853 - 140902)	----+--------+--------+--------+--------+----* AAATGATTTTGTACATAAAGTTCAATAATATAAAGCTGTCTTCTGCTTTT

Gene/Protein Characteristic Table for mKIAA0160

Features of the cloned DNA sequence

Features of the protein sequence