ROUGE |
Gene/Protein Characteristic Table for mKIAA0160 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122213 |
---|---|
Polycomb protein Suz12. | |
mbh04611 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4304 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2296 bp Genome contig ID gi65527427f_79618877 PolyA signal sequence
(ATTAAA,-21) +----*----+----*----+----*----+----
ACGTTTGTTTTTACATTAAATGTTTATTTGAAATCFlanking genome sequence
(140853 - 140902) ----+----*----+----*----+----*----+----*----+----*
AAATGATTTTGTACATAAAGTTCAATAATATAAAGCTGTCTTCTGCTTTT
KIAA Alignment based on: KIAA0160 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 2..1990, 2007..2426
Length: 802 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |