ROUGE

Gene/Protein Characteristic Table for mKIAA0094

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129054
Description :	Methionine aminopeptidase 1.
Clone Name :	mpm02131 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4665 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1386 bp

Genome contig ID gi65492966r_137248188
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
TGTAAAGGGAGATTAAACGTTTGAATGATTATCCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTTTTCTAGTTGTATTTGTTGGGATTTCAGAGGGAATCGACGGGAATA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0094 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0094	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 784..1077, 2680..3279
Length: 297 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8BP48	2.9e-109	94.2	Methionine amin...	Mus musculus
EDL82321	6.4e-109	93.5	methionyl amino...	Rattus norvegicus
XP_544993	2.1e-108	93.1	similar to Meth...	Canis lupus fam...
XP_001099172	3e-108	93.1	methionyl amino...	Macaca mulatta
Q5RBF3	6.6e-108	92.8	Methionine amin...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001714 104 117 PR00599 Peptidase M24

IPR001714 126 142 PR00599 Peptidase M24

IPR001714 196 208 PR00599 Peptidase M24

IPR001714 227 239 PR00599 Peptidase M24

HMMPfam IPR000994 44 284 PF00557 Peptidase M24

HMMTigr IPR002467 35 285 TIGR00500 Peptidase M24A

ScanRegExp IPR002467 202 220 PS00680 Peptidase M24A

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001714	104	117	PR00599	Peptidase M24
IPR001714	126	142	PR00599	Peptidase M24
IPR001714	196	208	PR00599	Peptidase M24
IPR001714	227	239	PR00599	Peptidase M24
HMMPfam	IPR000994	44	284	PF00557	Peptidase M24
HMMTigr	IPR002467	35	285	TIGR00500	Peptidase M24A
ScanRegExp	IPR002467	202	220	PS00680	Peptidase M24A

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1386 bp
Genome contig ID	gi65492966r_137248188
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- TGTAAAGGGAGATTAAACGTTTGAATGATTATCCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTTTTCTAGTTGTATTTGTTGGGATTTCAGAGGGAATCGACGGGAATA

Gene/Protein Characteristic Table for mKIAA0094

Features of the cloned DNA sequence

Features of the protein sequence