ROUGE

Gene/Protein Characteristic Table for mKIAA0063

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK004913
Description :	Josephin 1.
Clone Name :	mbh02903 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 3356 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1833 bp

Genome contig ID gi65543215r_79626569
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
GTTTAACCAAATATTAAAAATGAAAAGCTGAACAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGTCTACTTGTCTGATTATGTAAAAACCTTTGGCAGGATTTTGTCATAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0063 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0063	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 885..1523
Length: 212 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9DBJ6	2.4e-90	100.0	Josephin-1; Jos...	Mus musculus
Q15040	5.1e-88	97.0	Josephin-1; Jos...	Homo sapiens
Q5BJY4	5.1e-88	97.0	Josephin-1; Jos...	Rattus norvegicus
XP_538372	5e-87	96.5	similar to Jose...	Canis lupus fam...
XP_001501689	7.8e-86	95.0	similar to Jose...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006155 35 209 PF02099 Machado-Joseph disease protein MJD

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006155	35	209	PF02099	Machado-Joseph disease protein MJD

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1833 bp
Genome contig ID	gi65543215r_79626569
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- GTTTAACCAAATATTAAAAATGAAAAGCTGAACAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTCTACTTGTCTGATTATGTAAAAACCTTTGGCAGGATTTTGTCATAG

Gene/Protein Characteristic Table for mKIAA0063

Features of the cloned DNA sequence

Features of the protein sequence