ROUGE

Gene/Protein Characteristic Table for mKIAA0051

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129044
Description :	Ras GTPase-activating-like protein IQGAP1.
Clone Name :	mpf00519 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 6100 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1052 bp

Genome contig ID gi65511124r_74415488
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
GAATCCTTTGTCTTTGGATTAAAAGTCATAAACTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAATCTCTTTATTCAAAAAGATAGTTAAATCATGCTACTGAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0051 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0051	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..5048
Length: 1681 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL06977	99.9	IQ motif contai...	Mus musculus
Q9JKF1	99.9	Ras GTPase-acti...	Mus musculus
AAH46385	99.8	IQ motif contai...	Mus musculus
EDM08655	99.0	IQ motif contai...	Rattus norvegicus
XP_523157	95.4	IQ motif contai...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
BC052916	1.6e-38	77.0	mKIAA4007

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR011575 1384 1681 PD008735 RasGAP

HMMPfam IPR001715 70 184 PF00307 Calponin-like actin-binding

IPR001202 705 734 PF00397 WW/Rsp5/WWP

IPR000048 770 790 PF00612 IQ calmodulin-binding region

IPR000048 800 820 PF00612 IQ calmodulin-binding region

IPR000048 830 850 PF00612 IQ calmodulin-binding region

IPR000048 860 880 PF00612 IQ calmodulin-binding region

IPR001936 1049 1262 PF00616 Ras GTPase-activating protein

IPR000593 1475 1607 PF03836 RasGAP protein

HMMSmart IPR001715 70 179 SM00033 Calponin-like actin-binding

IPR000048 768 790 SM00015 IQ calmodulin-binding region

IPR000048 798 820 SM00015 IQ calmodulin-binding region

IPR000048 828 850 SM00015 IQ calmodulin-binding region

IPR000048 858 880 SM00015 IQ calmodulin-binding region

IPR001936 1016 1369 SM00323 Ras GTPase-activating protein

ProfileScan IPR001715 68 183 PS50021 Calponin-like actin-binding

IPR000048 769 798 PS50096 IQ calmodulin-binding region

IPR000048 799 828 PS50096 IQ calmodulin-binding region

IPR000048 829 858 PS50096 IQ calmodulin-binding region

IPR000048 859 888 PS50096 IQ calmodulin-binding region

IPR001936 1028 1261 PS50018 Ras GTPase-activating protein

IPR000593 1399 1625 PS50243 RasGAP protein

ScanRegExp IPR001202 709 734 PS01159 WW/Rsp5/WWP

IPR001936 1213 1227 PS00509 Ras GTPase-activating protein

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR011575	1384	1681	PD008735	RasGAP
HMMPfam	IPR001715	70	184	PF00307	Calponin-like actin-binding
IPR001202	705	734	PF00397	WW/Rsp5/WWP
IPR000048	770	790	PF00612	IQ calmodulin-binding region
IPR000048	800	820	PF00612	IQ calmodulin-binding region
IPR000048	830	850	PF00612	IQ calmodulin-binding region
IPR000048	860	880	PF00612	IQ calmodulin-binding region
IPR001936	1049	1262	PF00616	Ras GTPase-activating protein
IPR000593	1475	1607	PF03836	RasGAP protein
HMMSmart	IPR001715	70	179	SM00033	Calponin-like actin-binding
IPR000048	768	790	SM00015	IQ calmodulin-binding region
IPR000048	798	820	SM00015	IQ calmodulin-binding region
IPR000048	828	850	SM00015	IQ calmodulin-binding region
IPR000048	858	880	SM00015	IQ calmodulin-binding region
IPR001936	1016	1369	SM00323	Ras GTPase-activating protein
ProfileScan	IPR001715	68	183	PS50021	Calponin-like actin-binding
IPR000048	769	798	PS50096	IQ calmodulin-binding region
IPR000048	799	828	PS50096	IQ calmodulin-binding region
IPR000048	829	858	PS50096	IQ calmodulin-binding region
IPR000048	859	888	PS50096	IQ calmodulin-binding region
IPR001936	1028	1261	PS50018	Ras GTPase-activating protein
IPR000593	1399	1625	PS50243	RasGAP protein
ScanRegExp	IPR001202	709	734	PS01159	WW/Rsp5/WWP
IPR001936	1213	1227	PS00509	Ras GTPase-activating protein

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1052 bp
Genome contig ID	gi65511124r_74415488
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- GAATCCTTTGTCTTTGGATTAAAAGTCATAAACTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAATCTCTTTATTCAAAAAGATAGTTAAATCATGCTACTGAG

Gene/Protein Characteristic Table for mKIAA0051

Features of the cloned DNA sequence

Features of the protein sequence