ROUGE

Gene/Protein Characteristic Table for mKIAA0049

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129043
Description :	Membrane component, chromosome 17, surface marker 2.
Clone Name :	mph02182 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4320 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1335 bp

Genome contig ID gi65527427f_101273972
PolyA signal sequence
(AATAAA,-31)
+----*----+----*----+----*----+----
TCTAAATAAACCACAATTCAAACTGCAAGCCAACC
Flanking genome sequence
(129071 - 129120)
----+----*----+----*----+----*----+----*----+----*
AAGCTGTTTATTGTTTAAAATGTTTTCCTGGGGTTTGGGGTAGAGGCAGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0049 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0049	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 238..2985
Length: 915 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAM21028	100.0	neighbor of Brc...	Mus musculus
EDL34054	100.0	neighbor of Brc...	Mus musculus
P97432	100.0	Next to BRCA1 g...	Mus musculus
AAF74118	99.9	testis-specific...	Mus musculus
EDL34057	100.0	neighbor of Brc...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000270 13 95 PF00564 Octicosapeptide/Phox/Bem1p

HMMSmart NULL 52 81 SM00016 NULL

IPR000433 221 266 SM00291 Zinc finger

ProfileScan IPR000433 221 267 PS50135 Zinc finger

ScanRegExp IPR000433 227 253 PS01357 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000270	13	95	PF00564	Octicosapeptide/Phox/Bem1p
HMMSmart	NULL	52	81	SM00016	NULL
IPR000433	221	266	SM00291	Zinc finger
ProfileScan	IPR000433	221	267	PS50135	Zinc finger
ScanRegExp	IPR000433	227	253	PS01357	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1335 bp
Genome contig ID	gi65527427f_101273972
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- TCTAAATAAACCACAATTCAAACTGCAAGCCAACC
Flanking genome sequence (129071 - 129120)	----+--------+--------+--------+--------+----* AAGCTGTTTATTGTTTAAAATGTTTTCCTGGGGTTTGGGGTAGAGGCAGA

Gene/Protein Characteristic Table for mKIAA0049

Features of the cloned DNA sequence

Features of the protein sequence