ROUGE

Gene/Protein Characteristic Table for mKIAA0034

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122193
Description :
Clone Name :	mbg01962 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6146 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2051 bp

Genome contig ID gi65527427r_86322645
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
CAATTTAAAATAAATTACTGGACTGTGGAAATAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGTAGAATTGCAGTTTTAATTAAATACATCTCAAACCAGAATCATGGTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0034 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0034	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 178..4092, 4094..5233
Length: 1684 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q68FD5	99.9	Clathrin heavy ...	Mus musculus
Q00610	99.8	Clathrin heavy ...	Homo sapiens
XP_537700	99.8	similar to Clat...	Canis lupus fam...
P49951	99.8	Clathrin heavy ...	Bos taurus
XP_001135961	99.8	clathrin heavy ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001473 29 66 PF01394 Clathrin propeller

IPR001473 70 104 PF01394 Clathrin propeller

IPR001473 112 143 PF01394 Clathrin propeller

IPR001473 158 197 PF01394 Clathrin propeller

IPR001473 208 244 PF01394 Clathrin propeller

IPR001473 263 298 PF01394 Clathrin propeller

IPR001473 306 340 PF01394 Clathrin propeller

IPR000547 547 689 PF00637 7-Fold repeat in clathrin and VPS proteins

IPR000547 696 838 PF00637 7-Fold repeat in clathrin and VPS proteins

IPR000547 843 982 PF00637 7-Fold repeat in clathrin and VPS proteins

IPR000547 989 1134 PF00637 7-Fold repeat in clathrin and VPS proteins

IPR000547 1138 1279 PF00637 7-Fold repeat in clathrin and VPS proteins

IPR000547 1284 1429 PF00637 7-Fold repeat in clathrin and VPS proteins

IPR000547 1432 1575 PF00637 7-Fold repeat in clathrin and VPS proteins

HMMSmart IPR000547 547 689 SM00299 7-Fold repeat in clathrin and VPS proteins

IPR000547 696 838 SM00299 7-Fold repeat in clathrin and VPS proteins

IPR000547 843 982 SM00299 7-Fold repeat in clathrin and VPS proteins

IPR000547 989 1134 SM00299 7-Fold repeat in clathrin and VPS proteins

IPR000547 1138 1279 SM00299 7-Fold repeat in clathrin and VPS proteins

IPR000547 1284 1429 SM00299 7-Fold repeat in clathrin and VPS proteins

IPR000547 1432 1591 SM00299 7-Fold repeat in clathrin and VPS proteins

ProfileScan IPR000547 547 689 PS50236 7-Fold repeat in clathrin and VPS proteins

IPR000547 696 838 PS50236 7-Fold repeat in clathrin and VPS proteins

IPR000547 843 982 PS50236 7-Fold repeat in clathrin and VPS proteins

IPR000547 989 1134 PS50236 7-Fold repeat in clathrin and VPS proteins

IPR000547 1138 1279 PS50236 7-Fold repeat in clathrin and VPS proteins

IPR000547 1284 1429 PS50236 7-Fold repeat in clathrin and VPS proteins

IPR000547 1432 1575 PS50236 7-Fold repeat in clathrin and VPS proteins

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001473	29	66	PF01394	Clathrin propeller
IPR001473	70	104	PF01394	Clathrin propeller
IPR001473	112	143	PF01394	Clathrin propeller
IPR001473	158	197	PF01394	Clathrin propeller
IPR001473	208	244	PF01394	Clathrin propeller
IPR001473	263	298	PF01394	Clathrin propeller
IPR001473	306	340	PF01394	Clathrin propeller
IPR000547	547	689	PF00637	7-Fold repeat in clathrin and VPS proteins
IPR000547	696	838	PF00637	7-Fold repeat in clathrin and VPS proteins
IPR000547	843	982	PF00637	7-Fold repeat in clathrin and VPS proteins
IPR000547	989	1134	PF00637	7-Fold repeat in clathrin and VPS proteins
IPR000547	1138	1279	PF00637	7-Fold repeat in clathrin and VPS proteins
IPR000547	1284	1429	PF00637	7-Fold repeat in clathrin and VPS proteins
IPR000547	1432	1575	PF00637	7-Fold repeat in clathrin and VPS proteins
HMMSmart	IPR000547	547	689	SM00299	7-Fold repeat in clathrin and VPS proteins
IPR000547	696	838	SM00299	7-Fold repeat in clathrin and VPS proteins
IPR000547	843	982	SM00299	7-Fold repeat in clathrin and VPS proteins
IPR000547	989	1134	SM00299	7-Fold repeat in clathrin and VPS proteins
IPR000547	1138	1279	SM00299	7-Fold repeat in clathrin and VPS proteins
IPR000547	1284	1429	SM00299	7-Fold repeat in clathrin and VPS proteins
IPR000547	1432	1591	SM00299	7-Fold repeat in clathrin and VPS proteins
ProfileScan	IPR000547	547	689	PS50236	7-Fold repeat in clathrin and VPS proteins
IPR000547	696	838	PS50236	7-Fold repeat in clathrin and VPS proteins
IPR000547	843	982	PS50236	7-Fold repeat in clathrin and VPS proteins
IPR000547	989	1134	PS50236	7-Fold repeat in clathrin and VPS proteins
IPR000547	1138	1279	PS50236	7-Fold repeat in clathrin and VPS proteins
IPR000547	1284	1429	PS50236	7-Fold repeat in clathrin and VPS proteins
IPR000547	1432	1575	PS50236	7-Fold repeat in clathrin and VPS proteins

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2051 bp
Genome contig ID	gi65527427r_86322645
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- CAATTTAAAATAAATTACTGGACTGTGGAAATAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGTAGAATTGCAGTTTTAATTAAATACATCTCAAACCAGAATCATGGTT

Gene/Protein Characteristic Table for mKIAA0034

Features of the cloned DNA sequence

Features of the protein sequence