ROUGE

Gene/Protein Characteristic Table for mKIAA0025

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172874
Description :	Homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 1 protein.
Clone Name :	mni27227 [Vector Info]
Source :	Mouse NKT cells

Features of the cloned DNA sequence	Description

Length: 1864 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 603 bp

Genome contig ID gi65515060f_93570680
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
TTTCTGTTCAATAAAGTTTTGCTATGAATGACTGT
Flanking genome sequence
(108853 - 108902)
----+----*----+----*----+----*----+----*----+----*
AGCAGAGACTCCCATTGTCCTGGCAAGCTTGCTGTGTCTTTTGTCACTGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0025 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0025	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1261
Length: 419 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL11126	5.4e-167	99.8	homocysteine-in...	Mus musculus
Q9JJK5	1.3e-156	100.0	Homocysteine-re...	Mus musculus
AAH13523	3.1e-156	99.7	Homocysteine-in...	Mus musculus
BAC38293	1.9e-155	99.7	unnamed protein...	Mus musculus
BAB16047	4.8e-149	94.9	SUP [Rattus nor...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000626 38 117 PF00240 Ubiquitin

HMMSmart IPR000626 38 115 SM00213 Ubiquitin

ProfileScan IPR000626 38 100 PS50053 Ubiquitin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000626	38	117	PF00240	Ubiquitin
HMMSmart	IPR000626	38	115	SM00213	Ubiquitin
ProfileScan	IPR000626	38	100	PS50053	Ubiquitin

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	603 bp
Genome contig ID	gi65515060f_93570680
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- TTTCTGTTCAATAAAGTTTTGCTATGAATGACTGT
Flanking genome sequence (108853 - 108902)	----+--------+--------+--------+--------+----* AGCAGAGACTCCCATTGTCCTGGCAAGCTTGCTGTGTCTTTTGTCACTGG

Gene/Protein Characteristic Table for mKIAA0025

Features of the cloned DNA sequence

Features of the protein sequence